How does a gene direct the synthesis of a protein

You may recall from Chapter 2 that both DNA and proteins are polymers whose 'building blocks' (nucleotides and amino acids respectively) can be put together in an almost infinite number of sequences. The sequence of amino acids making up the primary structure of a protein is determined by the sequence of nucleotides in the particular gene responsible for its production. It does this not directly, but through an intermediary molecule, now known to be a form of RNA called messenger RNA (mRNA). It is this intermediary that carries out the crucial task of passing the information encoded in the DNA sequence to the site of protein synthesis. This unidirectional flow of information can be summarised:

and is often referred to as the Central Dogma of biology, because of its applicability to all forms of life. Proposed by Crick in the late 1950s, this is still accepted as being a true model of the basic events in protein synthesis. Sometimes the message encoded in DNA is transcribed into either ribosomal RNA (rRNA) or transfer RNA (tRNA); these types of RNA are not translated into proteins but represent end-products in themselves. (In the last chapter, we saw that retroviruses have proved an exception to one part of the Central Dogma, since they possess enzymes capable of forming DNA from an RNA template.)

The conversion of information encoded as DNA into the synthesis of a polypeptide chain occurs in two distinct phases (Figure 11.5); first the 'message' encoded in the

DNA replication

> Protein

DNA replication

WHAT EXACTLY DO GENES DO? DNA ATGACCCAGCGTAGTGCGGGC

TACTGGGTCGCATCACGCCCG (Template strand) mRNA AUGACCCAGCGUAGUGCGGGC

Figure 11.5 Transcription and translation. The sequence on one strand of DNA is transcribed as a molecule of mRNA (with uracil replacing thymine). The triplet code on the mRNA is then translated at ribosomes as a series of amino acids

DNA sequence of a gene is converted to mRNA by transcription, then this directs the assembly of a specific sequence of amino acids during translation. We shall discuss how this happens shortly, but first we need to consider the question: how does the sequence of nucleotides in a gene serve as an instruction in the synthesis of proteins?

0 0

Post a comment